Cite as: Cold Spring Harb. Protoc.; 2007; doi:10.1101/pdb.prot4730

This Protocol
Right arrow Abstract Freely available
Right arrow Open Access Protocol
Right arrow Update/discuss this protocolDiscussion icon
Right arrow Alert me when this protocol is cited
Right arrow Alert me when comments are published
Right arrow Alert me if a correction is posted
Services
Right arrow Similar protocols in this database
Right arrow Alert me to new releases of protocols
Right arrow Save to Personal Folders
Right arrow Download to citation manager
Right arrow Printer-friendly versionPrinter-friendly version
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Müller, S.
Right arrow Articles by Cremer, M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Müller, S.
Right arrow Articles by Cremer, M.
Related Collections
Right arrow Cell Biology, general
Right arrow Visualization, general
Right arrow Fluorescence
Right arrow Fluorescence, general
Right arrow Labeling for Imaging
Right arrow Molecular Biology, general
Right arrow Analysis of Gene Expression
Right arrow Analysis of Gene Expression, general
Right arrow Probes
Right arrow Probes, general
Right arrow Oligonucleotide Probes
Right arrow Non-isotopically Labeled Probes
Right arrow RNA, general
Right arrow In Situ Hybridization
Right arrow Visualization of Gene Expression
Right arrow Polymerase Chain Reaction (PCR)
Right arrow Polymerase Chain Reaction (PCR), general
Right arrowRelated Protocols
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Legend icon

protocolProtocol

Preparation of Complex DNA Probe Sets for 3D FISH with up to Six Different Fluorochromes

Stefan Müller1, Michaela Neusser, Daniela Köhler, and Marion Cremer

Ludwig-Maximilians University Munich, Department Biology II, AG Thomas Cremer (Chair of Anthropology and Human Genetics), 82152 Martinsried-Planegg, Germany

1Corresponding author (S.Mueller@lrz.uni-muenchen.de)


INTRODUCTION

DNA probes for fluorescence in situ hybridization (FISH) can be generated and labeled by various methods. This protocol describes the conjugation of dUTPs with haptens or fluorochromes, as well as the generation and labeling of DNA probes using those modified dUTPs. Sources of probe DNA include genomic DNA, DNA from flow-sorted chromosomes, bacterial artificial chromosomes (BACs), and cosmids. DNA amplification and labeling procedures involving degenerate oligonucleotide-primed PCR (DOP-PCR) and multiple displacement amplification (MDA) are provided. Advice is given for setting up complex probe pools, such as those containing large pools of BAC probes. Also included is a method for probe precipitation and preparation of a hybridization mix ready to be used for 3D fluorescence in situ hybridization (FISH) experiments.


RELATED INFORMATION

Figure 1 presents an overview of the methods involved here, as well as in Cell Preparation and Multicolor FISH in 3D Preserved Cultured Mammalian Cells, and FISH on Histological Sections.

Figure 1. Overview of methods involved in performing FISH on cultured cells and tissue sections. Protocol 4730 is described herein, Protocol 4723 corresponds to Cell Preparation and Multicolor FISH in 3D Preserved Cultured Mammalian Cells, and Protocol 4729 corresponds to FISH on Histological Sections.


MATERIALS

Reagents

Use chemicals of high purity ("p.A." grade). Prepare solutions for primary PCR reactions with DNA-free and DNase-free H2O.

recipe ACG mix (for degenerate oligonucleotide primed [DOP]-PCR labeling only; see Step 21)

recipe ACGT mix (for human pancentromere and mouse major satellite PCR only; see Steps 45 and 48)

Agarose gels (1%) and appropriate size markers

Bicarbonate buffer (0.2 M NaHCO3; store at –20°C) (Sigma-Aldrich)

Cot-1 DNA (Invitrogen)

caution Detergent W1 (Polyoxyethylene ether W1, 1%, Sigma-Aldrich)

caution DMSO

DNA polymerase I (Roche) (for nick translation only; see Step 7)

DNase I stock solution (2000 U/ml) (Roche) (for labeling by nick translation and multiple displacement amplification [MDA]; see Steps 6-11 and 33-44)

DNA samples to be used as probes

recipe dNTP mix (for primary and secondary DOP only; see Steps 12 and 16)

recipe dNTP mix for NT (for nick translation only; see Step 7)

dTTP (1 mM in H2O, autoclaved; store at –20°C) (for DOP-PCR labeling only; see Step 21)

dUTP (aminoallyl-dUTP, 20 mM in bicarbonate buffer; stored at –20ºC) (Sigma-Aldrich)

recipe EDTA (0.5 M, pH 8.0) (Titriplex III, Merck) (for nick translation only; see Step 10)

Ethanol (Merck) (ice-cold)

Fluorochrome and/or hapten:

caution Biotin succinimidyl ester (bio) (Molecular Probes)

Cy3 mono NHS ester (Cy3, Amersham)

Cy5 mono NHS ester (Cy5, Amersham)

caution Digoxigenin succinimidyl ester (dig) (Molecular Probes)

caution Dinitrophenyl aminohexanoic acid succinimidyl ester (DNP) (Molecular Probes)

caution FITC succinimidyl ester (FITC) (Molecular Probes)

TAMRA succinimidyl ester (TAMRA) (Molecular Probes)

Texas Red succinimidyl ester (Texas Red) (Molecular Probes)

caution Formamide (Merck)

GeneAmp PCR buffer (10X) (Applied Biosystems) (for labeling by DOP-PCR or for human pancentromere and mouse major satellite PCR; see Steps 21, 45, and 48)

GenomiPhi DNA Amplification Kit (GE Healthcare) (for MDA only; see Steps 26-44)

Glycine (2 M, pH 8.0) (Amersham)

recipe Hybridization master mix

MgCl2 (25 mM) (Merck)

cautionß-Mercaptoethanol (100 mM in H2O; stored at –20°C) (Merck)

Nick translation (NT) buffer (10X) (Roche) (for nick translation only; see Step 7)

PCR buffer D (5X) (Invitrogen) (for DOP-PCR only; see Steps 12 and 16)

Primers:

6 MW (100 µM): CCGACTCGAGNNNNNNATGTGG (for DOP-PCR only; see Steps 12, 16, and 21)

{alpha}27 (100 µM): CATCACAAAGAAGTTTCTGAGGCTTC (for Step 45 only)

{alpha}30 (100 µM): TGCATTCAACTCACAGAGTTGAACCTTCC (for Step 45 only)

MMS-F (25 µM): GCGAGAAAACTGAAAATCAC (for Step 48 only)

MMS-R (25 µM): TCAAGTCGTCAAGTGGATG (for Step 48 only)

Salmon sperm DNA (Invitrogen)

Taq polymerase (5 U/µl) (GE Healthcare) (for DOP-PCR or human pancentromere and mouse major satellite PCR; see Steps 12, 17, 22, 45, and 48)

recipe Tris-HCl (1 M, pH 7.8, 8.0) (Sigma-Aldrich)

Equipment

Apparatus for agarose gel electrophoresis

Centrifuge

Ice

Lyophilizer (SpeedVac)

Pipettes and filter tips

A fresh set of pipettes and filter tips that have not previously been used for handling DOP-PCR amplified products is required for Primary Amplification of DNA Probes by DOP-PCR (Steps 12-15).

Shaker

Spectrophotometer (optional; see Steps 47 and 50)

Thermocycler

Tubes (0.6-ml PCR, DNase-free; 1 ml, 1.5 ml)

Vacuum centrifuge (optional; see Step 54)

Water bath preset to 15ºC, 37ºC

Additional water baths at 30ºC (Steps 3, 29, and 40), 65ºC (Steps 30 and 41), and 95ºC (Steps 28 and 35) may be required.


METHOD

Conjugation of dUTPs with Hapten or Fluorochrome (~5 h)

Fluorochrome- or hapten-conjugated nucleotides (dUTPs) for probe labeling are commercially available, but it is preferable to conjugate dUTPs with haptens or fluorochromes in house. This is a simplified method initially described by (Henegariu et al. 2000). See also http://info.med.yale.edu/genetics/ward/tavi/n_coupling.html for haptens and fluorochromes that are routinely used for conjugation reactions.

1. Dilute the hapten or fluorochrome in DMSO as shown below. Store dilutions at –20°C for up to several months.
Hapten / fluorochrome Quantity delivered in commercial product Amount of DMSO to add Final concentration

Biotin succinimidyl ester (bio) 100 mg 4401 µl 40 mM
Cy3 mono NHS ester 1 mg 66 µl 20 mM
Cy5 mono NHS ester 1 mg 62 µl 20 mM
Digoxigenin succinimidyl ester (dig) 5 mg 213 µl 40 mM
Dinitrophenyl aminohexanoic acid succinimidyl ester (dnp) 25 mg 1562 µl 40 mM
FITC succinimidyl ester 10 mg 417 µl 40 mM
TAMRA succinimidyl ester 10 mg 1560 µl 10 mM
Texas Red succinimidyl ester 5 mg 612 µl 10 mM

2. Mix the reagents for the appropriate conjugation reaction as follows.
i. For dig-, dnp-, and Texas Red-dUTP labeling, mix the following:
20 mM dUTP 10 µl
H2O 15 µl
0.2 M bicarbonate buffer 10 µl
DMSO 10 µl
Dissolved hapten/fluorochrome 10 µl
Total 55 µl

ii. For bio-dUTP labeling, mix the following:
20 mM dUTP 10 µl
H2O 15 µl
0.2 M bicarbonate buffer 10 µl
40 mM bio 10 µl
Total 45 µl

iii. For Cy3-, FITC-, and Cy5-dUTP labeling, mix the following:
20 mM dUTP 10 µl
H2O 10 µl
0.2 M bicarbonate buffer 10 µl
Dissolved fluorochrome 10 µl
Total 40 µl

iv. For TAMRA-dUTP labeling, mix the following:
20 mM dUTP 10 µl
H2O 10 µl
0.2 M bicarbonate buffer 10 µl
10 mM TAMRA 20 µl
Total 50 µl

3. Incubate each reaction at 30°C for 3-4 hours in thermocycler or water bath.

4. Add 2 µl of 2 M glycine (pH 8.0) to stop the reaction, 4 µl of 1 M Tris-HCl (pH 7.8) to stabilize the nucleotides, and H2O to adjust the total volume to 200 µl.
The concentration of each respective conjugated dUTP is now 1 mM.

5. Prepare aliquots of labeled dUTPs (e.g., 20 µl). Store them at –20ºC (except dnp-dUTP, which should be stored at 4ºC) for up to several years.

Labeling DNA by Nick Translation (~3 h)

Nick translation (NT) can be used to label various sources of DNA (dissolved in either H2O or 10 mM Tris-Cl, pH 8.0) if sufficient starting material is available. Because the reaction does not involve DNA amplification, it requires large amounts of source DNA.

6. Dilute the DNase I stock solution (2000 U/ml) 1:250 in ice-cold H2O, and keep on ice.

7. Mix the following reagents in a 1-ml tube. Keep all reagents on ice.
A 50-µl reaction volume is suitable for 500 ng-3 µg DNA. For larger DNA amounts, increase the volume of the reaction accordingly.
Reagent Amount to add Final concentration

DNA 500 ng-3 µg
NT buffer (10X) 5 µl 1X
ß-Mercaptoethanol (100 mM) 5 µl 10 mM
dNTP mix for NT 5 µl 50 µM dATP, dCTP, dGTP each; 10 µM dTTP
Modified dUTP (1 mM) 2.5 µl (add 5 µl of fluorochrome-labeled nucleotide) 50 µM (or 100 µM for fluorochrome-labeled nucleotides)
DNase I (from Step 6) 1 µl 0.008 U
DNA polymerase I 1 µl 0.1 U/µl
H2O to 50 µl

8. Incubate the reaction mixture for 90 minutes at 15°C.
The activity of DNase I appears to be variable and may depend on the DNA source, purity and DNA storage buffer. Titrate the amount of DNase I added and/or the incubation time to obtain DNA fragments of the appropriate size. Plasmids may be more sensitive to DNase I compared to BAC clones and thus may require higher dilution (1:750 to 1:1000) and/or a reduction in incubation time.

9. Check the length of the resulting DNA fragments with an aliquot of 5 µl on a 1% agarose gel with appropriate size markers (e.g., lambda HindIII). Keep the remaining solution at –20°C.
A perfect NT reaction should yield a smear of DNA fragments of ~300-1000 bp. If further digestion is necessary (e.g., if much of the DNA is >1.5 kb), add 1 µl of diluted DNase I, incubate for 5-10 minutes at 20°C, and check the DNA fragment size again on an agarose gel.

10. Once the desired fragment size is obtained, add 1 µl of 0.5 M EDTA to permanently stop the reaction.

11. Use the NT product immediately for probe preparation (Step 51) or store it at –20°C for up to several years.

Generation of DNA Probes by DOP-PCR

FISH experiments with complex DNA probes require large amounts of probe DNA (50 ng up to several µg). DOP-PCR (Telenius et al. 1992) uses the primer 6-MW or a modified DOP primer set as described in Fiegler et al. (2003). It can be performed with minimal amounts of source material (picogram to nanogram range). Only after the fourth round of reamplification is the probe quality is considerably reduced.

Primary Amplification of DNA Probes by DOP-PCR (~6 h)

To avoid contamination with foreign DNA, set up primary amplifications using a fresh set of filter tips and pipettes that have not previously been used for handling DOP-PCR amplified products. Ideally, perform primary DOP-PCR reactions in a separate room with reagents exclusively used for these reactions.

Prior to the primary amplification of BAC DNA, treat the BAC DNA with RNase and adjust its concentration to ~50-100 ng/µl. The DNA should be dissolved in H2O or 10 mM Tris-HCl (pH 8.0).

12. Mix the following reagents in a 0.6-ml DNase-free tube:
Reagents Amount Final concentration

Flow-sorted chromosomes in H2O or genomic DNA ~500 chromosomesor ~1-100 ng DNA
PCR Buffer D (5X) 10 µl 1X
6-MW primer (100 µM) 1 µl 2 µM
Detergent W1 (1%) 5 µl 0.1%
dNTP mix (2.5 mM each) 4 µl 200 µM
Taq polymerase (5 U/µl) 0.5-1 µl 2.5-5 U
H2O to 50 µl

13. Perform the primary amplification in a thermocycler as follows:
Number of cycles Reaction Temperature Time

1 Initial denaturation 96°C 3 minutes
8 (low-stringency cycles) Denaturation 94°C 1 minute
Annealing 30°C 1 minute 30 seconds
Extension 3-minute ramp (14°C/min) followed by 2 minutes at 72°C
35 (high-stringency cycles) Denaturation 94°C 1 minute
Annealing 56°C 1 minute
Extension 72°C 2 minutes
1 Final extension 72°C 5 minutes

A primary amplification normally yields several micrograms of DNA, depending on the amount of template DNA. For example, with 50 ng of template DNA, the expected yield of a 50-µl primary DOP-PCR would be 1.5-10 µg of DNA (30-200 ng/µl).

14. Check 2 µl of amplification product on a 1% agarose gel with appropriate size markers.
The amplification product should yield a visible smear ranging between ~200 bp and 1.5 Kb.

15. Use the amplified DNA for the secondary DOP-PCR (Step 17) or store at –20°C for up to several years.

Reamplification of DNA Probes by DOP-PCR (~5 h)
Reamplification increases the amount of DNA. Secondary DOP-PCR product can be used as a template for labeling DNA (Step 21). The composition of secondary and subsequent amplification reactions is the same as that for primary amplification, but cycling parameters differ.

16. For frequently used reamplification reactions with the 6-MW primer, prepare a master mix that contains all reagents except for DNA and Taq polymerase. It can be stored at –20°C for several years. For a master mix sufficient for 20 x 50-µl reactions, mix the following reagents in a 1-ml tube:
Reagent Amount Final concentration

PCR Buffer D 5X 200 µl 1X
6-MW primer (100 µM) 20 µl 2 µM
Detergent W1 (1%) 100 µl 0.1%
dNTP mix (2.5 mM each) 80 µl 200 µM
H2O 570 µl -

17. In a 0.6-ml PCR tube, mix the following:
Master mix (from Step 16) 48.5 µl
DOP-PCR amplified DNA (from Step 15) 1 µl (usually corresponds to 30-200 ng)
Taq polymerase (5 U/µl) 0.5 µl

For the simultaneous amplification of several painting probes or BAC clones, prepare a prepool containing primary DOP-PCR-amplified DNA from each component in equal amounts. (DNA from up to 20 BACs or a large number of chromosome painting probes works well.) Usually 1 µl of the prepooled DNA is sufficient as a template for secondary DOP-PCR, but this can be increased to 3 µl for a standard DOP-PCR reamplification reaction. Perform a trial FISH experiment using metaphase preparations. If necessary, balance the prepools by adding DNA from under-represented BACs to ensure that each member of the pool shows equal hybridization signal intensity.

18. Perform (re)amplification in a thermocycler as follows:
Number of cycles Reaction Temperature Time

1 Initial denaturation 96°C 3 minutes
35 (high-stringency cycles) Denaturation 94°C 1 minute
Annealing 56°C 1 minute
Extension 72°C 2 minutes
1 Final extension 72°C 5 minutes

With 50 ng of template DNA, the expected yield of a 50-µl DOP-PCR is 1.5 µg-10 µg DNA (30-200 ng/µl).

19. Run 2 µl of amplification product on a 1% agarose gel with appropriate size markers.
Amplification product should yield a visible smear ranging from ~200 bp-1.5 kb.

20. Use the amplified DNA for the labeling DOP-PCR (see Steps 21-25) or store at -20°C for up to several years.

Labeling of Probes by DOP-PCR (~3 h)

21. For frequently used labeling reactions with the 6-MW primer, prepare a master mix that contains all reagents except DNA and Taq polymerase. It can be stored at –20°C for several years. For a master mix sufficient for 20 x 50-µl reactions, mix together the following reagents in a 1-ml tube:
Reagent Amount Final concentration

GeneAmp PCR Buffer (10X) 100 µl 1X
MgCl2 (25 mM) 80 µl 2 mM
6-MW primer (100 µM) 20 µl 2 µM
ACG mix (2 mM each) 50 µl 100 µM
dTTP (1 mM) 80 µl 80 µM
Bio-, dig-, or dnp-dUTP or fluor-dUTP (e.g., FITC-dUTP) (1 mM) (from Step 5) 20 µl(40-60 µl for fluor-dUTPs) 20-60 µM
H2O to 970 µl -

22. Mix together on ice in a 0.6-ml PCR tube:
Master mix (from Step 16) 48 µl
DOP-PCR-(re)amplified DNA (from Step 20) 1 µl (usually corresponds to 30-200 ng)
Taq polymerase (5 U/µl) 0.5 µl

For the simultaneous labeling of several probes (chromosome-specific painting probes or BACs) with the same hapten or fluorochrome, label a prepool containing several DNA probes as described in the note in Step 17 and use 1-2 µl of template DNA for the DOP-PCR labeling reaction.

23. Perform the labeling reaction in a thermocycler as follows:
Number of cycles Reaction Temperature Time

1 Initial denaturation 94°C 3 minutes
20-25 Denaturation 94°C 1 minute
Annealing 56°C 1 minute
Extension 72°C 30 seconds
1 Final extension 72°C 5 minutes

With 50 ng of template DNA, the expected yield of a 50-µl DOP-PCR labeling reaction is 1.5-10 µg DNA (30-200 ng/µl)

24. Run 2 µl of amplification product on a 1% agarose gel with appropriate size markers.
Amplification products should yield a visible smear ranging between ~200 bp and 1.5 kb.

25. Use the labeled DNA in probe preparation (Step 51) or store it at –20°C for up to several years.

Preparation of DNA Probes by Multiple Displacement Amplification (MDA)

Our recommended method for efficient DNA probe amplification from small amounts of genomic, BAC, or cosmid DNA is multiple displacement amplification (MDA). This approach provides a highly uniform representation of the amplified product across the genome. A commercial product called the GenomiPhi DNA Amplification Kit (GE Healthcare) works well in our hands. Store all reagents from the kit at –80°C, and handle them on ice.

DNA Amplification by MDA Using the GenomiPhi DNA Amplification Kit (~18 h)

This method is based on an isothermal MDA of DNA by Phi29 polymerase and subsequent NT (Steps 6-11).

26. Pipet 9 µl of sample buffer into a 0.6-ml tube.

27. Add 1 µl of template DNA (minimum 5 ng; recommended amount is >10 ng), and mix.
To simultaneously label multiple DNAs in a single reaction, prepare a prepool containing equal amounts of DNA from each source (e.g., DNA from up to 20 BACs or 10 cosmids works well). Ensure that 1 µl of a prepool contains >10 ng of each BAC DNA. Amplify the prepool by MDA and label the amplification product by NT (see Steps 6-11). Perform a trial FISH experiment using metaphase preparations. If necessary, balance the prepools by adding DNA from under-represented BACs to the prepool to ensure that each member of the pool shows equal hybridization signal intensity.

28. Denature the DNA for 3 minutes at 95°C in thermocycler or water bath.

29. Add 9 µl of reaction buffer and 1 µl of enzyme mix. Incubate for 16 hours (or a maximum of 24 h) at 30°C in thermocycler or water bath.

30. Heat-inactivate the enzyme for 10 minutes at 65°C in thermocycler or water bath.

31. Check 1 µl of product on a 1% agarose gel with appropriate size markers.
The reaction should yield 6-12 µg with product sizes ranging from ~2-12 kb.

32. Use the amplified DNA for NT (see Steps 6-11) or store it at –20°C.

DNA Probe Labeling by MDA Using the GenomiPhi DNA Amplification Kit (~18 h)
This is a modified MDA which allows for simultaneous DNA probe amplification and labeling with hapten-dUTPs (bio-dUTP, dig-dUTP, dnp-dUTP). Labeling by NT is thus unnecessary. In our hands, this protocol can only be used with hapten-dUTPs, not with fluorochrome-coupled dUTPs (e.g., FITC-dUTP or Cy3-dUTP).

33. Pipet 9 µl of sample buffer into a 0.6-ml tube.

34. Add 1 µl of template DNA (minimum 5 ng; recommended amount is >10 ng), and mix.

35. Denature the DNA for 3 minutes at 95°C in thermocycler or water bath.

36. Lyophilize 5 µl of 1 mM hapten-dUTP (from Step 5) in a SpeedVac.

37. Dissolve the hapten-dUTP in 9 µl of reaction buffer.

38. Add 1 µl of enzyme mix to the hapten-dUTP and reaction buffer, and mix.

39. Mix 10 µl of sample buffer/DNA (from Step 34) and 10 µl of reaction buffer/hapten-dUTP/enzyme (from Step 38).

40. Incubate the reaction for 16 hours at 30°C in thermocycler or water bath.

41. Heat-inactivate the enzyme for 10 minutes at 65°C in thermocycler or water bath

42. Check 1 µl of the product on a 1% agarose gel with appropriate size markers.
The reaction should yield 6-12 µg with product sizes ranging from ~2 to 12 kb.

43. Digest 20 µl of MDA product with 1 µl of DNase I (2000 U/ml stock solution diluted 1:250 in H2O) for 6 minutes at room temperature.
The resulting fragment size should be 300-1000 bp.

44. Store the probe at -20°C.

Generation of Probes for Human Pancentromeric DNA and Mouse Major Satellite DNA

Centromere-specific probes are widely used in 3D-FISH experiments. To generate probes for human pancentromeric DNA (Steps 45-47) and mouse major satellite DNA (Steps 48-50), first amplify the repetitive sequences by specific primer sequences and then label the primary amplified DNA by NT (see Steps 6-11).

PCR Amplification of a Probe for Human Pancentromeric DNA (~3 h)

45. Mix the following reagents in a 0.6-ml tube:
Reagent Amount Final concentration

GeneAmp PCR buffer (10X) 10 µl 1X
MgCl2 (25 mM) 8 µl 2 mM
{alpha}27 Primer (100 µM) 2 µl 2 µM
{alpha}30 Primer (100 µM) 2 µl 2 µM
Genomic DNA (100 ng/µl) 2 µl 2 ng/µl
ACGT mix (2 mM each) 5 µl 100 µM
Taq polymerase (5 U/µl) 0.8 µl 0.04 U/µl
H2O to 100 µl -

46. Perform PCR in a thermocycler as follows:
Number of cycles Reaction Temperature Time

1 Initial denaturation 94°C 3 mins
35 Denaturation 94°C 45 sec
Annealing 62°C 1 min, 20 sec
Extension 72°C 1 min, 20 sec
1 Final extension 72°C 5 min

47. Check DNA concentration on a gel or photometrically and use 2 µg for NT (Steps 6-11).

PCR Amplification of a Probe for Mouse Major Satellite DNA (~3 h)

48. Mix the following reagents in a 0.6-ml tube
Reagent Amount Final concentration

GeneAmp PCR buffer (10X) 10 µl 1X
MgCl2 (25 mM) 8 µl 2 mM
MMS-F primer (25 µM) 4 µl 1 µM
MMS-R primer (25 µM) 4 µl 1 µM
Genomic DNA (10 ng/µl) 10 µl 1 ng/µl
ACGT mix (2 mM each) 5 µl 100 µM
Taq polymerase (5 U/µl) 0.8 µl 0.04 U/µl
H2O to 100 µl -

49. Perform PCR in a thermocycler as follows:
Number of cycles Reaction Temperature Time

1 Initial denaturation 94°C 3 min
35 Denaturation 94°C 1 min
Annealing 56°C 1 min
Extension 72°C 2 min
1 Final extension 72°C 5 min

50. Check DNA concentration on a gel or photometrically and use 2 µg for NT (Steps 6-11).

Probe Preparation, Precipitation, and Setup (~2-20 h)

When genomic DNA probes (i.e. chromosome paints, BAC clones) are hybridized together with repetitive DNA probes, Cot-1 DNA can reduce the hybridization signal of highly repetitive sequences. Use higher amounts of repetitive probes, or, preferably, prepare separate hybridization mixtures (0.5X volume each) for genomic and repeat probes.

51. Mix the following three reagents in a 1.5-ml tube:
i. All labeled DNA probes that will be hybridized together.
For repetitive probes, use 1-10 ng DNA/µl hybridization mixture; for nonrepetitive probes, use 20-100 ng DNA/µl hybridization mixture. Use 2 µl of labeled PCR product per 1 µl of hybridization mix for chromosome painting probes or locus-specific probes. It may be helpful to increase the concentrations for small nonrepetitive probes, e.g., plasmids.

ii. Unlabeled competitor DNA (e.g. Cot-1 DNA), representing 10-50-fold the concentration of probe DNA (depending on the frequency of repetitive sequences in the probe).
For complex probe mixtures, assume that the probes suppress each other and reduce the amount of Cot-1 DNA.

iii. 20 µg of unlabeled salmon sperm DNA (for efficient precipitation).
This is especially important for precipitation of small amounts of DNA.
52. Mix the DNA from Step 51 with ice-cold 100% ethanol (2.5X volumes). Leave for at least 30 minutes, but preferably overnight at –20°C or –80°C.

53. Centrifuge the DNA at 13,000 rpm for 20 minutes.

54. Discard the supernatant, and dry the pellet (using a vacuum centrifuge if available).

55. Resuspend the pellet in an appropriate amount of 100% formamide by shaking at 37°C.
Resuspension may take several hours.

56. Add an equal volume of hybridization master mix. Briefly mix and incubate at 37°C for 10 minutes. The final concentrations are 50% formamide/1X SSC/10% dextran sulfate.
Probes are ready to hybridize as described in Cell Preparation and Multicolor FISH in 3D Preserved Cultured Mammalian Cells and FISH on Histological Sections. The area covered by an 18 x 18-mm coverslip requires 5-8 µl of hybridization mixture. Adjust this for smaller or larger hybridization areas.
Probes containing segments with partial homology to other chromosomes may require higher final concentrations of formamide (e.g., 70%) to reduce nonspecific hybridization (e.g., cross-hybridization of centromeric probes can be prevented by hybridization in 70% formamide).

57. Store hybridization probes at -20°C for up to several years.


TROUBLESHOOTING

The quality of a DNA probe to be used in FISH experiments can only be reliably determined by a trial FISH experiment (see Cell Preparation and Multicolor FISH in 3D Preserved Cultured Mammalian Cells and FISH on Histological Sections). Before proceeding with FISH, be sure to check the DNA amount and fragment size of the labeled probe.

Problem: The signal is weak.

Solution: Try the following:

1. Increase the amount of probe.

2. If there is poor incorporation of labeled nucleotides (recognizable by a large amount of nucleotides in the gel), repeat the reaction.

Problem: The background is too high.

Solution: Try the following:

1. Fragments that are too long may cause nonspecific background. DNase treatment should help.

2. The probe may not have been completely dissolved in formamide. Dissolve again.


DISCUSSION

High-quality labeled DNA probes (e.g., Fig. 2 ) are crucial for efficient 3D-FISH experiments. Factors such as probe complexity, amount of probe available, and the hapten used will influence which method to use for probe labeling. Direct probe labeling by incorporation of fluorochrome-conjugated nucleotides (e.g., FITC-dUTP, Texas Red-dUTP) has been quite successful and is as efficient as hapten-labeled probes (e.g., biotin, digoxigenin, and dinitrophenol). NT is very reliable for labeling probes and is still widely used. Most DNA probes may also be efficiently labeled by PCR amplification techniques, which save time and material. PCR increases the probe amount during labeling, whereas NT does not. Thus, a significantly higher amount of probe material is required when probes are labeled by NT.

Figure 2. Three-color 3D FISH on nuclei of normal diploid human fibroblasts. Maximum intensity projections of confocal serial sections are shown. Chromosome territories (CTs) 3 are in green (labeled with dinitrophenol, detected with FITC), CTs 5 are in blue (labeled with digoxigenin, detected with Cy3), and CTs 11 are in red (labeled with biotin, detected with Cy5). Each paint yields a strong signal with little nonspecific background.

NT generates labeled DNA that is equivalent to the probe input, whereas DOP-PCR is prone to losing complexity during amplification, which can eventually lead to a significant loss of specific sequences within the complex probe mix. This can be especially extensive if several rounds of DOP-PCR are performed prior to probe labeling. Thus, DOP-PCR works well for most template DNAs, including total genomic DNA and BAC clones, but is not recommended for cosmids or plasmids. DOP-PCR is particularly useful for the amplification of chromosome painting probes, which are usually generated from flow-sorted chromosomes and may be obtained from genome project resource centers or from commercial sources. Typically, 500 flow-sorted chromosomes (~50 pg, depending on the chromosome) are delivered in ~30 µl H2O. Isothermal MDA, a relatively new alternative to DOP-PCR for the amplification of complex probe sets, is based on a phage polymerase and random hexamer primers (Dean et al. 2001). In contrast to DOP-PCR, it seems to be much less sensitive to the loss of probe complexity. It yields excellent DNA probes from small amounts of source DNA with a highly uniform representation of the amplified and labeled product across the genome.


REFERENCES

Cremer, M., Müller, S., Köhler, D., Brero, A., and Solovei, I. 2007. Cell preparation and multicolor FISH in 3D preserved cultured mammalian cells. CSH Protocols doi:10.1101/pdb.prot4723.

Dean, F.B., Nelson, J.R., Giesler, T.L., and Lasken, R.S. 2001. Rapid amplification of plasmid and phage DNA using Phi 29 DNA polymerase and multiply-primed rolling circle amplification. Genome Res 11: 1095–1099.[Abstract/Free Full Text]

Fiegler, H., Carr, P., Douglas, E.J., Burford, D.C., Hunt, S., Scott, C.E., Smith, J., Vetrie, D., Gorman, P., Tomlinson, I.P., et al. 2003. DNA microarrays for comparative genomic hybridization based on DOP-PCR amplification of BAC and PAC clones. Genes Chromosomes Cancer 36: 361–374.[Medline]

Henegariu, O., Bray-Ward, P., and Ward, D.C. 2000. Custom fluorescent-nucleotide synthesis as an alternative method for nucleic acid labeling. Nat. Biotechnol 18: 345–348.[Medline]

Solovei, I., Grasser, F., and Lanctôt, C. 2007. FISH on histological sections. CSH Protocols doi:101101/pdb.prot4729.

Telenius, H., Carter, N.P., Bebb, C.E., Nordenskjold, M., Ponder, B.A., and Tunnacliffe, A. 1992. Degenerate oligonucleotide-primed PCR: General amplification of target DNA by a single degenerate primer. Genomics 13: 718–725.[Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related Protocols

Cell Preparation and Multicolor FISH in 3D Preserved Cultured Mammalian Cells
Marion Cremer, Stefan Müller, Daniela Köhler, Alessandro Brero, and Irina Solovei
Cold Spring Harb Protoc 2007: 4723. [Abstract] [Full Text]

FISH on Histological Sections
Irina Solovei, Florian Grasser, and Christian Lanctôt
Cold Spring Harb Protoc 2007: 4729. [Abstract] [Full Text]