Cite as: Cold Spring Harb. Protoc.; 2007; doi:10.1101/pdb.prot4824

This Protocol
Right arrow Abstract Freely available
Right arrow Update/discuss this protocolDiscussion icon
Right arrow Alert me when this protocol is cited
Right arrow Alert me when comments are published
Right arrow Alert me if a correction is posted
Services
Right arrow Similar protocols in this database
Right arrow Alert me to new releases of protocols
Right arrow Save to Personal Folders
Right arrow Download to citation manager
Right arrow Printer-friendly versionPrinter-friendly version
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heninger, A.-K.
Right arrow Articles by Buchholz, F.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Heninger, A.-K.
Right arrow Articles by Buchholz, F.
Related Collections
Right arrow RNA Interference (RNAi)/siRNA
Right arrow Cell Biology, general
Right arrow Cell Culture
Right arrow Genetics, general
Right arrow High-Throughput Analysis, general
Right arrow Laboratory Organisms, general
Right arrow Mouse
Right arrow Molecular Biology, general
Right arrow Analysis of Gene Expression
Right arrow RNA
Right arrow RNA, general
Right arrow mRNA
Right arrow Developmental Biology
Right arrow Genome Analysis
Right arrow Analysis of Gene Expression in Cultured Cells
Right arrowRelated Protocol
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
BSN globe

protocolProtocol

Production of Endoribonuclease-Prepared Short Interfering RNAs (esiRNAs) for Specific and Effective Gene Silencing in Mammalian Cells

Anne-Kristin Heninger and Frank Buchholz1

Max Planck Institute of Molecular Cell Biology and Genetics, 01307 Dresden, Germany

1Corresponding author (buchholz{at}mpi-cbg.de)


INTRODUCTION

The mechanism of RNA interference has emerged as a practical tool to study loss of function in many organisms. To make the method of gene knockdown suitable for mammalian cells, short interfering double-stranded RNAs (siRNAs) need to be applied. This protocol describes a straightforward, low-cost method, which uses recombinant Escherichia coli RNase III to digest long dsRNA into endoribonuclease-prepared short interfering RNAs (esiRNAs). Advantages of this technology are the high efficiency and specificity of the resulting esiRNA and its usefulness for not only small-scale applications, but also high-throughput loss-of-function analyses. Another great asset of esiRNA is its flexibility in design, using Web-based tools such as DEQOR, or predesigned esiRNA sequences from the database RiDDLE. PCR products flanked with T7 promoter sequences are generated, transcribed, and annealed. The resulting long dsRNA is enzymatically digested into a pool of overlapping esiRNAs, which are subsequently spin-column-purified.


RELATED INFORMATION

This protocol is based on a method described by Buchholz et al. (2004). An overview is provided in Figure 1 .

Figure 1. Overview of the procedure for generating esiRNA. Important steps of the process are described adjacent to the arrows.


MATERIALS

Reagents

Agarose

BIOTAQ Red DNA polymerase and 10X NH4 reaction buffer (Bioline)

cDNA template

DNA marker with fine resolution (e.g., 25-bp DNA ladder, HyperLadder V; Bioline)

dNTP mix (100 mM; Bioline)

Do a 1:10 dilution of the dNTP mix to use in PCR (Steps 4 and 6).

recipe dsRNA digestion buffer

recipe esiRNA elution buffer

recipe esiRNA equilibration buffer

recipe esiRNA wash buffer

Ethanol (70%), cold, freshly prepared

GST-RNase III, purified as in Buchholz et al. (2004)

Alternatively, commercially available enzymes, for example, E. coli RNase III (Ambion or EPICENTRE Biotechnologies) or recombinant Dicer (Ambion, Roche Applied Science, or Genlantis), may be purchased.

caution Isopropanol

MEGAscript T7 kit (Ambion)

MgCl2 (50 mM; Bioline)

recipe Orange G gel loading buffer

Primers with full T7 RNA polymerase promoter tag (for PCR 2; see Step 6):

Forward: GCTAATACGACTCACTATAGGGAGAG

Reverse: GCTAATACGACTCACTATAGGGAGAC

Q-Sepharose FastFlow (Amersham Biosciences)

Equipment

DEQOR (http://cluster-1.mpi-cbg.de/Deqor/deqor.html) (optional; see Step 2)

Equipment for agarose gel electrophoresis (see Agarose Gel Electrophoresis)

For large-scale purification (Steps 30-42):

96-well deep-well plates (1.1-mL; Nerbe)

96-well PCR plates and deep-well plates (Nerbe)

96-well UNIFILTER plates (Whatman)

Incubator, preset to 37°C

Multifuge 4KR (Thermo)

Plate shaker

Silicon seals for deep-well plates (Nerbe)

For small-scale purification (Steps 17-29):

Empty spin columns (Micro Bio-Spin Chromatography Columns; Bio-Rad Laboratories)

Microcentrifuge tubes (2-mL)

Speed Vac

Microcentrifuge

Primer design software (e.g., Primer3; http://frodo.wi.mit.edu/)

RiDDLE (http://cluster-12.mpi-cbg.de/cgi-bin/riddle/search) (optional; see Step 2)

Shaker, at room temperature and 37°C (see Steps 13-14)

Spectrophotometer

Thermal cycler

Vortex mixer

Water bath at 95°C


METHODS

Primer Design

1. Choose an optimal gene-silencing region for PCR.
For good digestion conditions in later steps, it is best to use a template that is 400-600 bp in length. Shorter templates often incur difficulties in digestion, whereas with longer amplicons, dsRNA annealing problems can be encountered.

2. Design a primer pair using one of these three options:
We generally use the program Primer3 to find optimal primer sequences. Primer sequences should be 20-22 nt long and have a 60°C optimum melting temperature.
i. Select a desired sequence, and design primers that specifically target the transcript of interest.

ii. Run the sequence of the chosen transcript through the software program DEQOR, and select the region with the best-scoring silencing sequence (Henschel et al. 2004).

iii. For preselected, DEQOR-optimized esiRNAs, use the database RiDDLE. The output will offer a ready-to-use primer pair.
The RiDDLE database is especially useful for the production of genome-wide or large subset esiRNA libraries, because it proposes optimal esiRNA template regions and their amplifying primer pairs for human, mouse, and rat genomes (Kittler et al. 2007).
3. Attach the following part of the T7 RNA polymerase promoter sequence to the 5'-end of each primer: TCACTATAGGGAGAG (for the forward primer) and TCACTATAGGGAGAC (for the reverse primer).
Thus, each primer is 35-37 nt long. In addition, the different 3'-ends, G and C, can be used to facilitate sequencing or directional cloning of the PCR fragment.

Template Generation

4. Assemble a 25-µL PCR (PCR 1) using cDNA as a template.
10X NH4 reaction buffer 2.5 µL
50 mM MgCl2 0.8 µL
10 mM dNTP mix 2.0 µL
5 µM forward primer (from Steps 1-3) 1.0 µL
5 µM reverse primer (from Steps 1-3) 1.0 µL
Template cDNA 100 ng
BIOTAQ Red polymerase (1 U/µL) 1.0 µL
H2O Up to 25 µL

5. Perform a "touch-up" PCR with the following temperature settings and cycles:
Number of cycles Temperature Time
1 94°C 2-3 min
60°C 30 sec
72°C 30 sec
5 94°C 30 sec
60°C 30 sec
72°C 30 sec
6 94°C 30 sec
62°C 30 sec
72°C 30 sec
22 94°C 30 sec
65°C 30 sec
72°C 30 sec
1 72°C 5 min
End 5°C {infty}

If the products are analyzed by agarose gel electrophoresis at this point, it is possible that a band will not be visible, especially for genes expressed at low levels.

6. Perform a second round of PCR (PCR 2) with the full T7 RNA polymerase promoter tag to amplify the fragment. For this purpose, assemble a 50-µL reaction using the PCR 1 product from Step 5 as a template.
10X NH4 reaction buffer 5.0 µL
50 mM MgCl2 2.0 µL
10 mM dNTP mix 4.0 µL
10 µM forward primer 1.0 µL
10 µM reverse primer 1.0 µL
Template from PCR 1 1.5 µL
BIOTAQ Red polymerase (1 U/µL) 2.0 µL
H2O 33.5 µL

7. Perform the following PCR protocol, adjusting the annealing and extension times to match the expected length of the amplicon. Running 42 cycles achieves saturation, which normalizes the amount of DNA used in subsequent steps for most samples.
Number of cycles Temperature Time
1 94°C 2-3 min
60°C 30 sec
72°C 30 sec
41 94°C 30 sec
60°C 30 sec
72°C 30 sec
1 72°C 5 min
End 5°C {infty}

8. Verify the length of the PCR product by analyzing 3-5 µL of PCR 2 product (from Step 7) on a 1.5% (w/v) agarose gel.
See Troubleshooting.

In Vitro Transcription to Generate Long dsRNA

9. Assemble a 10-µL in vitro transcription reaction by mixing at least 250 ng of the verified PCR 2 product and the components of the MEGAscript T7 kit as follows:
10X T7 reaction buffer 1 µL
ATP (75 mM) 1 µL
CTP (75 mM) 1 µL
GTP (75 mM) 1 µL
UTP (75 mM) 1 µL
PCR 2 product 4 µL
T7 enzyme mix 1 µL

10. Perform the following in vitro transcription and annealing protocol in a thermal cycler:
37°C 4-12 h
90°C 3 min
Ramp to 70°C 0.1°C/sec
70°C 3 min
Ramp to 50°C 0.1°C/sec
50°C 3 min
Ramp to 25°C 0.1°C/sec
20°C {infty}

There is enough product after 4 h of incubation at 37°C; however, we generally see more product and more uniform results after a 12-h incubation. For large sample sets, therefore, it is better to aim for 12 h.
Do not freeze the annealed product because this enhances the formation of aggregates, thus impeding digestion.

11. Check the in vitro transcription product by analyzing 0.5 µL on a 1.5% (w/v) agarose gel (see Fig. 2 , lane 1).
Figure 2. GST-RNase III digestion of long dsRNA. Different amounts of GST-RNase III were added to long dsRNA samples, which had been in vitro-transcribed from a 450-bp DNA fragment tagged with T7 promoter sequences. The samples were incubated for 6 h and run on a 4% (w/v) agarose gel. (M) DNA ladder, with the 25- and 50-bp bands indicated; (lane 1) 0.5 µL of in vitro transcription product; (lanes 2,3) 3 µL of digestion product resulting from 2 µg and 3 µg (both insufficient) of GST-RNase III, respectively; (lanes 4,5) 3 µL of digestion product resulting from 5 µg (sufficient) and 15 µg (excess) of GST-RNase III, respectively; (lane 6) 21-bp chemically synthesized siRNA (800 ng).
If BIOTAQ Red DNA polymerase was used for amplification, a successful in vitro transcription usually results in a color change from red to yellow or orange, which is probably due to a pH alteration in the reaction as the supply of NTPs is exhausted. This visual check is especially helpful when working in a 96-well format.
See Troubleshooting.

Digestion to Generate a Pool of Short dsRNAs

12. To the 10 µL of transcription product, add 90 µL of dsRNA digestion buffer containing 5 µg of purified or commercially available GST-RNase III. It is critical to vortex thoroughly to ensure optimal digestion.
Because each stock of GST-RNase III and each type of purchased enzyme may differ in specific activity, it is best to titrate each new batch to determine the amount that is optimal for digestion (see Fig. 2). Typically, 5 µg of enzyme is sufficient to digest 30-100 µg of dsRNA in this protocol.

13. Centrifuge the solution briefly to remove any liquid from the lid. Shake the sample at 1400 rpm for 4 h at room temperature.

14. Briefly centrifuge again, and allow further digestion for 2 more hours at 37°C, continuing to shake the sample at 1400 rpm if possible.

15. Dilute a 3-µL aliquot of the digestion product in 3 µL of Orange G gel loading buffer.
The remaining digestion product can be frozen at -20°C. Continue processing the samples within 1 wk (see "Purification of esiRNA," Steps 17-42).

16. Run the sample on a 4% (w/v) agarose gel, using a fine-resolution marker (e.g., Hyperladder V) to analyze the size of the digestion product.
Because a gel of such concentration is difficult to produce using a microwave to melt the agarose, it is best to incubate the mixture for 90 min at 95°C in a water bath.
The resulting band smear should be below 30 bp, while most of the product should be in the 15-25-bp range (see Fig. 2, lane 5).
See Troubleshooting.

Purification of esiRNA

For small-scale synthesis of esiRNA in individual tubes, use Method A (Steps 17-29). For large-scale purification in 96-well deep-well plates, follow Method B (Steps 30-42).

Method A: Small-Scale Purification of esiRNA

17. Add 200 µL of well-mixed Q-Sepharose slurry to each micro spin column. Place the column into an empty microcentrifuge tube.

18. Add 500 µL of esiRNA equilibration buffer to each column, centrifuge at 1000g for 1 min, and discard the flow-through.

19. Repeat Step 18.

20. Load the digestion product from Step 14 onto the column, centering the tip of the micropipette on the top of the matrix, without disturbing the resin. Incubate for 5 min at room temperature.

21. Centrifuge at 1000g for 1 min and discard the flow-through.

22. Add 500 µL of esiRNA wash buffer, centrifuge at 1000g for 1 min, and discard the collection tube containing the flow-through. Place the column into a clean, 2-mL microcentrifuge tube.

23. Elute the esiRNA by adding 300 µL of esiRNA elution buffer to the column and centrifuging at 1000g for 1 min, collecting the flow-through.

24. Repeat Step 23.

25. Add 500 µL of isopropanol to the eluate, close the cap, and vortex. Store the mixture for at least 1 h at -20°C.
At this point, the dsRNA can be allowed to precipitate overnight at -20°C.

26. Centrifuge at 16,000g for 15 min at 4°C.

27. Carefully discard the supernatant, and wash the pellet with 500 µL of cold 70% (v/v) ethanol. Centrifuge at 16,000g for 5 min at 4°C.

28. Repeat Step 27.

29. Again, carefully discard the supernatant and dry the esiRNA pellet in a Speed-Vac. Proceed to Step 43.

Method B: Large-Scale Purification of esiRNA

30. Prepare the spin columns by adding 200 µL of well-mixed Q-Sepharose slurry into the empty wells of a Whatman 96-well filter plate. Place the filter plate onto an empty 96-well deep-well plate (waste plate).

31. Add 500 µL of esiRNA equilibration buffer to each column, centrifuge at 1000g for 1 min, and discard the flow-through.

32. Repeat Step 31.

33. Load the digestion product from Step 14 onto the columns, centering the tip of the micropipette on the top of the matrix, without disturbing the resin. Incubate for 5 min at room temperature.

34. Centrifuge at 1000g for 1 min, and discard the flow-through.

35. Add 500 µL of wash buffer, centrifuge at 1000g for 1 min, and discard the flow-through.

36. Place a clean 96-well deep-well plate under the filter plate. Elute the esiRNA by adding 270 µL of esiRNA elution buffer to the column and centrifuging at 1000g for 1 min, collecting the flow-through.

37. Repeat Step 36.

38. Remove the filter plate, and add 400 µL of isopropanol to each well. Seal the plate with a silicon seal, and vortex it several times. Store the samples for at least 1 h at -20°C.
At this point, the dsRNA can be allowed to precipitate overnight at -20°C.

39. Centrifuge at 4400g for at least 50 min at 4°C.

40. Carefully discard the supernatant, and wash each pellet with 300 µL of cold 70% (v/v) ethanol. Centrifuge at 4400g for 5 min at 4°C.

41. Repeat Step 40.

42. Again, carefully discard the supernatant, and dry the esiRNA pellet by incubating the open plate for 2 h at 37°C. Continue with Step 43.

Analysis of Purified esiRNA

43. Resuspend each pellet in 50-100 µL of H2O.

44. Analyze the size of the purified product by electrophoresis on a 4% (w/v) agarose gel. For this purpose, mix 3 µL of esiRNA solution and 3 µL of Orange G gel loading buffer. Compare the samples with a suitable marker.
See Troubleshooting.

45. Determine the esiRNA concentration by measuring OD260.
Generally, yields of 30-40 µg of product are achieved.
See Troubleshooting.

46. Store the esiRNA at -20°C. It is stable at this temperature for >6 mo.
The esiRNA can be used directly in transfection of mammalian cells.


TROUBLESHOOTING

Problem: There is no PCR product after the PCR 2 reaction.

[Step 8]

Solution: Check if the primer sequences for PCR 1 included the T7 promoter tag (see Step 3).

Problem: There is no transcription product.

[Step 11]

Solution: Check all primer sequences to make sure they included the accurate T7 promoter sequence (see Step 3).

Problem: Most of the digestion product smear extends up to 50 bp (Fig. 2, lane 3).

[Step 16]

Solution: Add an extra 2 µg of digestion enzyme, and incubate 1 more hour at 37°C.

Problem: Most of the product is still larger than 50 bp (Fig. 2, lane 2).

[Step 16]

Solution: Add an extra 4 µg of digestion enzyme, and incubate 1 more hour at 37°C.

Problem: Most of the digestion product is smaller than 21 bp (Fig. 2, lane 5).

[Step 16]

Solution: The esiRNA is overdigested. Repeat the procedure starting with Step 9, using either more DNA template for in vitro transcription, or less enzyme for digestion.

Problem: There is no product after purification (Step 44), although there was digestion product (Step 16).

[Step 44]

Solution: This is probably because of a lost pellet. Repeat the procedure, more carefully discarding the supernatant during the isopropanol and 70% ethanol wash steps. After each high-speed centrifugation step, immediately continue with the next procedure.

Problem: The final yield of purified esiRNA is very low.

[Step 45]

Solution: Ensure that 200 µL of Q-Sepharose was added to the column (in either Step 17 or Step 30), and remember to incubate the columns for 5 min when esiRNA is loaded (in either Step 20 or 33). In addition, be sure to use at least 250 ng of DNA template for in vitro transcription (see Step 9), and avoid any overdigestion of the sample. If necessary, perform a small-scale titration of the enzyme used in digestion with a given amount of dsRNA (see Step 12).


DISCUSSION

The use of RNA interference (RNAi) first emerged in plants and nematodes, where the introduction of long dsRNA into the organism allowed gene-specific silencing. In most mammalian cells, however, long dsRNA elicits a nonspecific interferon response. To circumvent this problem, chemically synthesized small interfering (si)RNAs of ~21 nt in length have been used in most protocols involving mammalian cells. These siRNAs are rather costly, and for each siRNA, it is difficult to find the most efficiently silencing 21-bp sequence. Furthermore, single siRNAs typically produce a siRNA-specific, off-target effect. In contrast, the esiRNAs are efficient, specific, cost-effective, and easy to produce in both small and large scale, thus allowing the generation of large sets and even genome-wide esiRNA libraries to be applied in high-throughput loss-of-function studies (Kittler et al. 2007).


REFERENCES

Buchholz, F., Drechsel, D., Ruer, M., and Kittler, R. 2004. Production of siRNA in vitro by enzymatic digestion of double-stranded RNA. In Gene silencing by RNA: Technology and application (ed. M. Sohail), pp. 87–99. CRC Press, Boca Raton, FL.

Henschel, A., Buchholz, F., and Habermann, B. 2004. DEQOR: A web-based tool for the design and quality control of siRNAs. Nucleic Acids Res. 32: W113–W120.[Abstract/Free Full Text]

Kittler, R., Surendranath, V., Heninger, A.K., Slabicki, M., Theis, M., Putz, G., Franke, K., Caldareli, A., Grabner, H., Kozak, K., et al. 2007. Genome-wide resources of endoribonuclease-prepared short interfering RNAs for specific loss-of-function studies. Nat. Methods 4: 337–344.[Medline]


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related Protocol

Agarose Gel Electrophoresis
Joseph Sambrook and David W. Russell
CSH Protocols 2006: 4020. [Extract] [Full Text]