Corrigendum

Corrigendum: Taxonomic Profiling of Fecal and Intestinal Microbiota in the African Turquoise Killifish Nothobranchius furzeri

  1. Dario Riccardo Valenzano

Cold Spring Harb Protoc 2023; doi: 10.1101/pdb.prot107749

In an earlier version of this protocol, in Table 1, the sequence for iP5/P5 was inadvertently given as: AATGATACGGCGACCACCGAGATCTACAC[i5-barcode]ACACTCTTTCCCTACACGACGCTCTTCCATCT. However, the correct sequence is AATGATACGGCGACCACCGAGATCTACAC[i5-barcode]ACACTCTTTCCCTACACGACGCTCTTCCGATCT. The authors apologize for this error. The current version of the protocol has been corrected.

| Table of Contents

This Article

  1. Published in Advance June 16, 2023, doi: 10.1101/pdb.corr108388 Cold Spring Harb Protoc 2023: pdb.corr108388- © 2023 Cold Spring Harbor Laboratory Press
  1. Correction to Seidel et al. 2023 (10): pdb.prot107749
  1. » Full Text
  2. Full Text (PDF)
  3. All Versions of this Article:
    1. pdb.corr108388v1
    2. 2023/10/pdb.corr108388 most recent

Article Category

  1. Corrigendum

Personal Folder

  1. Save to Personal Folders

Updates/Comments

  1. Submit Updates/Comments
  2. No Updates/Comments published
  3. Alert me when Updates/Comments are published

Share

Current Issue

  1. January 2026, 2026 (1)
  1. Current Issue