Corrigendum

Corrigendum: Taxonomic Profiling of Fecal and Intestinal Microbiota in the African Turquoise Killifish Nothobranchius furzeri

Cold Spring Harb Protoc 2023; doi: 10.1101/pdb.prot107749

In an earlier version of this protocol, in Table 1, the sequence for iP5/P5 was inadvertently given as: AATGATACGGCGACCACCGAGATCTACAC[i5-barcode]ACACTCTTTCCCTACACGACGCTCTTCCATCT. However, the correct sequence is AATGATACGGCGACCACCGAGATCTACAC[i5-barcode]ACACTCTTTCCCTACACGACGCTCTTCCGATCT. The authors apologize for this error. The current version of the protocol has been corrected.

No Related Web Pages
| Table of Contents

This Article

  1. Cold Spring Harb Protoc 2023: pdb.corr108388- © 2023 Cold Spring Harbor Laboratory Press
  1. All Versions of this Article:
    1. pdb.corr108388v1
    2. 2023/10/pdb.corr108388 most recent

Article Category

  1. Corrigendum

Personal Folder

  1. Save to Personal Folders

Updates/Comments

  1. Alert me when Updates/Comments are published

Related Content

  1. Related Web Pages

Share